Journal: Diagnostics

Article Title: GLUT3/SLC2A3 Is an Endogenous Marker of Hypoxia in Prostate Cancer Cell Lines and Patient-Derived Xenograft Tumors

doi: 10.3390/diagnostics12030676

Figure Lengend Snippet: GLUT3/SLC2A3 is highly upregulated in hypoxic conditions. ( a ) Principal component analysis plot showing RNA-seq profiles of prostate cells samples (S) at 0, 6, 12, and 24 h after exposure to hypoxic conditions (1% O 2 ). ( b ) Heatmap represents the log2 (expression) values of all genes that are differentially expressed (Padj < 0.05 and abs [log2FC] > 2) in all three time points relative to the 0 h normoxia samples (S1–3), and that are also members of the MSigDB Hallmark hypoxia gene set. Each row has been mean-centered to better show changes in expression over time. ( c ) Volcano plot showing the average log2FC over each time point (6, 12, and 24 h) relative to 0 h normoxia samples ( x -axis), and average significance (computed as −log10Padj) over each time point relative to 0 h normoxia samples ( y -axis). ( d ) Dot plot shows all upregulated MSigDB Hallmark gene sets with Padj < 0.05 and normalized enrichment score (NES) > 2 when performing gene set enrichment analysis on the average rank times the sign of the fold change across each of the three time points (6, 12, and 24 h) relative to 0 h normoxia samples. The size of the dot indicates the total number of genes annotated to the Hallmark gene set. Color of the dot indicates the Padj value. ( e ) Primers specific for GLUT3 or GLUT14 were used for RT-PCR to assess expression in total RNAs isolated from normoxic and 24 h hypoxic RWPE1 cells. Predicted sizes of the PCR products: GLUT3, 299 bp; GLUT14, 370 bp. Note, this assay was used to simply detect the transcript and was not a quantitative assay of transcript levels.

Article Snippet: Antibodies used include GLUT1 (Atlas, Fort Collins, CO, USA, HPA058494), GLUT3 (Proteintech, Rosemont, IL, USA, 20403-I-AP), and CA-9 (Novus, Littleton, CO, USA, NB100-417SS) at 1:1000 dilution.

Techniques: RNA Sequencing, Expressing, Reverse Transcription Polymerase Chain Reaction, Isolation

Journal: Diagnostics

Article Title: GLUT3/SLC2A3 Is an Endogenous Marker of Hypoxia in Prostate Cancer Cell Lines and Patient-Derived Xenograft Tumors

doi: 10.3390/diagnostics12030676

Figure Lengend Snippet: The GLUT3 protein is upregulated in hypoxic immortalized prostate epithelial cells. ( Upper and Middle panels) RWPE1 cells were cultured in either normoxic or under chronic hypoxic (1% O 2 ) conditions for 48 h and then processed for immunofluorescence microscopy. Cells were stained for either CA9, GLUT1, or GLUT3 (green, Upper and Middle panels). DNA, blue. Scale, 25 µm. ( Lower panels) Comparison of flow cytometry profiles of CA9, GLUT1, or GLUT3 in cells cultured in normoxia (red) versus hypoxia (yellow). Cells stained with only secondary antibody is shown (dark red). The fold increase in level of the indicated proteins is denoted. PE, phycoerythrin.

Article Snippet: Antibodies used include GLUT1 (Atlas, Fort Collins, CO, USA, HPA058494), GLUT3 (Proteintech, Rosemont, IL, USA, 20403-I-AP), and CA-9 (Novus, Littleton, CO, USA, NB100-417SS) at 1:1000 dilution.

Techniques: Cell Culture, Immunofluorescence, Microscopy, Staining, Comparison, Flow Cytometry

Journal: Diagnostics

Article Title: GLUT3/SLC2A3 Is an Endogenous Marker of Hypoxia in Prostate Cancer Cell Lines and Patient-Derived Xenograft Tumors

doi: 10.3390/diagnostics12030676

Figure Lengend Snippet: GLUT3 co-localizes with pimonidazole (Hypoxyprobe) in mouse xenograft tumors formed from prostate epithelial CTN-2-2 cells. Non-tumorigenic immortalized prostate epithelial PrEC-Hahn cells were transformed by transiently inducing chromosomal instability. The resulting tumorigenic line was named CTN-9, which produced malignant solid xenograft tumors in subcutaneously injected NSG mice . Cell lines isolated from these tumors were named CTN1-2 and 2-2 lines . ( Upper panel) Single tumor section stained for pimonidazole (PIMO) (green) and GLUT3 (red). DNA, blue. Boxed regions are shown at higher magnification in the lower panels. ( Lower panels) Higher magnification images from boxed regions 1 or 2 in upper panel. Serial tissue sections were stained for hematoxylin and eosin (H&E), PIMO (green), and GLUT3, GLUT1 or CA9 (red) as indicated. Concentrations of GLUT3 (yellow arrows) and CA9 (white arrows) that juxtapose with PIMO are marked. Dashed white boxes show GLUT3 concentrated at the plasma membrane in tumor cells (insets). Scale, 100 µm.

Article Snippet: Antibodies used include GLUT1 (Atlas, Fort Collins, CO, USA, HPA058494), GLUT3 (Proteintech, Rosemont, IL, USA, 20403-I-AP), and CA-9 (Novus, Littleton, CO, USA, NB100-417SS) at 1:1000 dilution.

Techniques: Transformation Assay, Produced, Injection, Isolation, Staining, Clinical Proteomics, Membrane

Journal: Diagnostics

Article Title: GLUT3/SLC2A3 Is an Endogenous Marker of Hypoxia in Prostate Cancer Cell Lines and Patient-Derived Xenograft Tumors

doi: 10.3390/diagnostics12030676

Figure Lengend Snippet: GLUT3 co-localizes with pimonidazole (Hypoxyprobe) in mouse xenograft tumors formed from prostate cancer DU145 cells. ( Upper panel) Single tumor section stained for pimonidazole (PIMO) (green) and GLUT3 (red). DNA, blue. Boxed regions are shown at higher magnification in the lower panels. ( Lower panels) Higher magnification images from boxed regions 1, 2, or 3 in upper panel. Serial tissue sections were stained for hematoxylin and eosin (H&E), PIMO (green), and GLUT3, GLUT1 or CA9 (red) as indicated. Concentrations of GLUT3 (yellow arrows) and CA9 (white arrows) that juxtapose with PIMO are marked. Dashed white boxes show GLUT3 concentrated at the plasma membrane in tumor cells (insets). Scale, 100 µm.

Article Snippet: Antibodies used include GLUT1 (Atlas, Fort Collins, CO, USA, HPA058494), GLUT3 (Proteintech, Rosemont, IL, USA, 20403-I-AP), and CA-9 (Novus, Littleton, CO, USA, NB100-417SS) at 1:1000 dilution.

Techniques: Staining, Clinical Proteomics, Membrane

Journal: Diagnostics

Article Title: GLUT3/SLC2A3 Is an Endogenous Marker of Hypoxia in Prostate Cancer Cell Lines and Patient-Derived Xenograft Tumors

doi: 10.3390/diagnostics12030676

Figure Lengend Snippet: Measurements of the co-localization of hypoxia markers in xenograft tumors show a high degree of association between pimonidazole and GLUT3. ( a ) Single section from a CTN2-2 tumor immunostained for pimonidazole (PIMO) (green) and GLUT3 (red). DNA, blue. Scale, 100 µm. ( b ) To quantify co-localization of hypoxia markers GLUT1, GLUT3, and CA9 with PIMO, binary tracings were placed around the PIMO signal (green lines) defined a threshold of intensity specific to each tumor. Binaries were then dilated >0–15 µm (orange lines) and >15–30 µm (red lines) to capture the adjacent signal of each hypoxia marker. Same image as in ( a ). ( c ) Graphs show fold change in mean fluorescence intensities of hypoxia markers GLUT1, GLUT3 and CA9 within three PIMO-positive or adjacent regions captured within the expanded binary masks: 0 µm where the PIMO signal resides, >0–15 µm (orange bars) and >15–30 µm (red bars). Mean fluorescence intensities within these three regions was divided by ‘background’ signal from regions >30 µm from the PIMO signal. A dashed line indicates no change in signal relative to the background. Four optical fields in tissue sections from two different DU145, CTN1-2 and CTN2-2 tumors were analyzed (six different tumors examined in total).

Article Snippet: Antibodies used include GLUT1 (Atlas, Fort Collins, CO, USA, HPA058494), GLUT3 (Proteintech, Rosemont, IL, USA, 20403-I-AP), and CA-9 (Novus, Littleton, CO, USA, NB100-417SS) at 1:1000 dilution.

Techniques: Marker, Fluorescence

Journal: Diagnostics

Article Title: GLUT3/SLC2A3 Is an Endogenous Marker of Hypoxia in Prostate Cancer Cell Lines and Patient-Derived Xenograft Tumors

doi: 10.3390/diagnostics12030676

Figure Lengend Snippet: Patient-derived xenograph (PDX) model of primary prostate cancer contains distinct pockets of GLUT3 staining. ( a ) Patient-derived xenograft (PDX) from a primary prostate tumor stained with H&E. Scale, 1.5 mm. ( b ) Section of PDX tumor immunostained for E-Cadherin (green) to mark cell borders and GLUT3 (red). DNA, blue. Boxed region is shown at higher magnification in ( c ). Scale, 250 µm. ( c ) Serial tissue sections were immunostained for either GLUT3 (red, left panel), a cocktail containing anti-GLUT1 and anti-CA9 antibodes (red, right panel), or antibodies against all three proteins GLUT1, GLUT3, and CA9 (red, middle panel) as indicated. Dashed white boxes show GLUT3 concentrated at the plasma membrane in tumor cells (insets). Scale, 100 µm.

Article Snippet: Antibodies used include GLUT1 (Atlas, Fort Collins, CO, USA, HPA058494), GLUT3 (Proteintech, Rosemont, IL, USA, 20403-I-AP), and CA-9 (Novus, Littleton, CO, USA, NB100-417SS) at 1:1000 dilution.

Techniques: Derivative Assay, Staining, Clinical Proteomics, Membrane

Journal: Diagnostics

Article Title: GLUT3/SLC2A3 Is an Endogenous Marker of Hypoxia in Prostate Cancer Cell Lines and Patient-Derived Xenograft Tumors

doi: 10.3390/diagnostics12030676

Figure Lengend Snippet: Patient-derived xenograph (PDX) model of bone metastatic prostate cancer contains distinct pockets of GLUT3 staining. ( Upper panel) Section of PDX tumor immunostained for E-Cadherin (green) to mark cell borders and GLUT3 (red). DNA, blue. Boxed regions are shown at higher magnification ( Lower panels). Scale, 500 µm. ( Lower panels) Higher magnification images from boxed regions 1 or 2 in upper panel. Serial tissue sections were stained with H&E (column 1) or immunostained for either GLUT3 (red, column 2), a cocktail containing anti-GLUT1, GLUT3, and CA9, antibodies (red, column 3), or antibodies against GLUT1 and CA9 (red, column 4) as indicated. Dashed white boxes show GLUT3 concentrated at the plasma membrane in tumor cells (insets). Scale, 100 µm.

Article Snippet: Antibodies used include GLUT1 (Atlas, Fort Collins, CO, USA, HPA058494), GLUT3 (Proteintech, Rosemont, IL, USA, 20403-I-AP), and CA-9 (Novus, Littleton, CO, USA, NB100-417SS) at 1:1000 dilution.

Techniques: Derivative Assay, Staining, Clinical Proteomics, Membrane

Journal: Diagnostics

Article Title: GLUT3/SLC2A3 Is an Endogenous Marker of Hypoxia in Prostate Cancer Cell Lines and Patient-Derived Xenograft Tumors

doi: 10.3390/diagnostics12030676

Figure Lengend Snippet: Compared to hypoxia biomarkers GLUT1 and CA9, GLUT3 labels larger areas within PDX tumor sections. ( a ) Patient-derived xenograft (PDX) from a primary prostate tumor immunostained with the triple anti-CA9, GLUT1, and GLUT3 antibody cocktail. Scale, 100 µm. ( b ) Same image as in ( a ) with binary mask to outline regions of the triple stain. ( c ) Graph shows measurements of total area of each stain within 3 different PDX prostate tumors. Three sequential sections were obtained from each tumor, stained for either CA9/GLUT1, GLUT3, or the triple stain CA9/GLUT1/GLUT3, and imaged. Total area of staining was quantified by masking regions of high intensity staining using Nikon Elements image analysis software. Note, in the metastatic prostate PDX tumor samples, the vast majority of the signal observed in the triple stain is due to the GLUT3 stain. However, in the primary prostate PDX, GLUT3 staining alone is not as effective at revealing putative hypoxic regions compared to the triple stain.

Article Snippet: Antibodies used include GLUT1 (Atlas, Fort Collins, CO, USA, HPA058494), GLUT3 (Proteintech, Rosemont, IL, USA, 20403-I-AP), and CA-9 (Novus, Littleton, CO, USA, NB100-417SS) at 1:1000 dilution.

Techniques: Derivative Assay, Staining, Software

Journal: Aging and Disease

Article Title: Limb Remote Ischemic Conditioning Ameliorates Cognitive Impairment in Rats with Chronic Cerebral Hypoperfusion by Regulating Glucose Transport

doi: 10.14336/AD.2020.1125

Figure Lengend Snippet: LRIC increased levels of GLUT1 and GLUT3 in the cerebral cortex as detected by Western blotting. (A and D) show levels of GLUT1 and GLUT3 at 1 week after treatment. (B and E) show levels of GLUT1 and GLUT3 at 2 weeks after treatment. (C and F) show levels of GLUT1 and GLUT3 at 4 weeks after treatment. * P <0.05, ** P <0.01, *** P <0.001. Bar graphs are mean±SD, n=10/group.

Article Snippet: The primary antibodies were rabbit anti-NeuN (1:300, Invitrogen, USA), mouse anti-GLUT1 and mouse anti-GLUT3 antibodies (1:400, Santa Cruz, USA).

Techniques: Western Blot

Journal: Aging and Disease

Article Title: Limb Remote Ischemic Conditioning Ameliorates Cognitive Impairment in Rats with Chronic Cerebral Hypoperfusion by Regulating Glucose Transport

doi: 10.14336/AD.2020.1125

Figure Lengend Snippet: LRIC increases levels of GLUT1 and GLUT3 in the cerebral cortex as detected by ELISA. (A and B) show the data obtained by ELISA in rats at 4 weeks after treatment. * P <0.05, *** P <0.001. Bar graphs are mean±SD, n=10/group. (C and D) show the Pearson correlation between escape latency time on the fifth day of training and GLUT1 and GLUT3, respectively. (E and F) show the Pearson correlation between time in the target quadrant on the fifth day of training and GLUT1 and GLUT3, respectively.

Article Snippet: The primary antibodies were rabbit anti-NeuN (1:300, Invitrogen, USA), mouse anti-GLUT1 and mouse anti-GLUT3 antibodies (1:400, Santa Cruz, USA).

Techniques: Enzyme-linked Immunosorbent Assay

Journal: Aging and Disease

Article Title: Limb Remote Ischemic Conditioning Ameliorates Cognitive Impairment in Rats with Chronic Cerebral Hypoperfusion by Regulating Glucose Transport

doi: 10.14336/AD.2020.1125

Figure Lengend Snippet: Immunofluorescence revealed that LRIC increased expression levels of GLUT1 and GLUT3 in the cortical neurons of 2VO rats. (A and B) show representations of immunofluorescence co-staining for GLUT1, GLUT3 and NeuN in the cerebral cortex. Scale bar=200 μm. (C) Bar graphs show the areas of GLUT1 + /NeuN + . D. Bar graphs show the areas of GLUT3 + /NeuN + . **P<0.01, ***P<0.001. Data shown are mean±SD, n=10/group.

Article Snippet: The primary antibodies were rabbit anti-NeuN (1:300, Invitrogen, USA), mouse anti-GLUT1 and mouse anti-GLUT3 antibodies (1:400, Santa Cruz, USA).

Techniques: Immunofluorescence, Expressing, Staining

Journal: Aging and Disease

Article Title: Limb Remote Ischemic Conditioning Ameliorates Cognitive Impairment in Rats with Chronic Cerebral Hypoperfusion by Regulating Glucose Transport

doi: 10.14336/AD.2020.1125

Figure Lengend Snippet: Dorsomorphin abolished the effect of LRIC on the expression of GLUT1 and GLUT3 detected by ELISA. (A) This bar graph shows the expression of GLUT1 after 4 weeks of treatment. (B) This bar graph shows the expression of GLUT3 after 4 weeks of treatment. * P <0.05, ** P <0.01, *** P <0.001, n=7/group.

Article Snippet: The primary antibodies were rabbit anti-NeuN (1:300, Invitrogen, USA), mouse anti-GLUT1 and mouse anti-GLUT3 antibodies (1:400, Santa Cruz, USA).

Techniques: Expressing, Enzyme-linked Immunosorbent Assay

Journal:

Article Title: Absence of SPARC leads to impaired lens circulation

doi: 10.1016/j.exer.2009.04.008

Figure Lengend Snippet: TaqMan Gene Expression Assays (Applied Biosystems)

Article Snippet: Fold-change was calculated using the relative quantitation comparative C t method ( Wong and Medrano, 2005 ). table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Gene Forward primer nM Reverse primer nM C4b TGCCTTCCGTCTCTTTGAGT 300 TGAAGGCATCTCCTCAATCC 300 Kcne1 TGCAGCCACTGCTTATTTTG 300 ACATGAGGGTGGGAAGAGTG 900 Kng1 GCGAGTACAAGGGCAGACTC 300 TCAGGGTGATGAAGACGATG 900 Serping1 AGCAACACAGGTTCCCAGTC 300 CTGCCAGTTCCTAAGGCTTG 900 Gapdh AACTTTGGCATTGTGGAAGG 900 ACACATTGGGGGTAGGAACA 900 Socs3 CCTTTGACAAGCGGACTCTC 900 GCCAGCATAAAAACCCTTCA 300 Open in a separate window Primer sequences (Invitrogen) table ft1 table-wrap mode="anchored" t5 Table 2 caption a7 Gene TaqMan Probe Adam23 Mm00625643_s1 Gad1 Mm00725661_s1 Gria1 Mm01342712_m1 Pcdh9 Mm03038601_m1 Slc1a1 Mm00436590_m1 Slc2a3 Mm03053806_s1 Slc8a1 Mm00619212_s1 Open in a separate window TaqMan Gene Expression Assays (Applied Biosystems) Glutamate immunohistochemistry Mouse lenses were fixed, frozen, and sectioned as previously described ( Jacobs et al., 2003 ).

Techniques: Gene Expression

Journal:

Article Title: Absence of SPARC leads to impaired lens circulation

doi: 10.1016/j.exer.2009.04.008

Figure Lengend Snippet: Selected genes with altered expression in SPARC-null lenses Gene expression results. The symbol (*) in the gene symbol column marks genes which have been previously reported in the lens. The symbol ( † ) in the qRT-PCR column indicates a qRT-PCR p-value <0.05. Fold-change describes the mRNA level in the SPARC-null lens relative to the wild-type lens. A positive number is higher expression and a negative number is lower expression in the SPARC-null lens. The column labeled qRT-PCR indicates fold-change as measured by quantitative RT-PCR.

Article Snippet: Fold-change was calculated using the relative quantitation comparative C t method ( Wong and Medrano, 2005 ). table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Gene Forward primer nM Reverse primer nM C4b TGCCTTCCGTCTCTTTGAGT 300 TGAAGGCATCTCCTCAATCC 300 Kcne1 TGCAGCCACTGCTTATTTTG 300 ACATGAGGGTGGGAAGAGTG 900 Kng1 GCGAGTACAAGGGCAGACTC 300 TCAGGGTGATGAAGACGATG 900 Serping1 AGCAACACAGGTTCCCAGTC 300 CTGCCAGTTCCTAAGGCTTG 900 Gapdh AACTTTGGCATTGTGGAAGG 900 ACACATTGGGGGTAGGAACA 900 Socs3 CCTTTGACAAGCGGACTCTC 900 GCCAGCATAAAAACCCTTCA 300 Open in a separate window Primer sequences (Invitrogen) table ft1 table-wrap mode="anchored" t5 Table 2 caption a7 Gene TaqMan Probe Adam23 Mm00625643_s1 Gad1 Mm00725661_s1 Gria1 Mm01342712_m1 Pcdh9 Mm03038601_m1 Slc1a1 Mm00436590_m1 Slc2a3 Mm03053806_s1 Slc8a1 Mm00619212_s1 Open in a separate window TaqMan Gene Expression Assays (Applied Biosystems) Glutamate immunohistochemistry Mouse lenses were fixed, frozen, and sectioned as previously described ( Jacobs et al., 2003 ).

Techniques: Expressing, Gene Expression, Labeling, Migration, Binding Assay, Coagulation, Activation Assay

Journal: BMC Endocrine Disorders

Article Title: Feto-placental endothelial dysfunction in Gestational Diabetes Mellitus under dietary or insulin therapy

doi: 10.1186/s12902-023-01305-6

Figure Lengend Snippet: Glucose uptake and ATP level was decreased in HUVECs from GDM-D and GDM-I. (A) Glucose uptake was determined in HUVECs from Normal (n = 6), GDM-D (n = 7), and GDM-I (n = 7). Western blot analysis showing expression level of GLUT1 (n = 9 per group) (B) and GLUT3 (n = 10 per group) (D). ATP levels in HUVECs from Normal (n = 6), GDM-D (n = 6), GDM-I (n = 11). H-scores of GLUT1 and GLUT3 in immunohistochemistry test (E, F). Representative photographs of immunohistochemistry staining in the indicated groups (G). Data are expressed as the means ± SD. The results were analyzed with one-way ANOVA test. (∗ P < 0.05, ∗∗ P < 0.01 compared with normal; # P < 0.05, ## P < 0.01 compared with GDM-D)

Article Snippet: After washing with PBS, enough drops of primary antibody for GLUT1 (Servicebio, rabbit polyclonal antibody), GLUT3 (Cellsignal, rabbit monoclonal antibody), p-AMPKα (Abcam, rabbit monoclonal antibody), p-AKT (Cellsignal, rabbit monoclonal antibody), and cleaved caspase-3 (Cellsignal, rabbit monoclonaln antibody) were separately added and incubated for 1 h. The secondary antibody was added thereafter.

Techniques: Western Blot, Expressing, Immunohistochemistry, Staining

Journal: bioRxiv

Article Title: RIP140 inhibits glycolysis-dependent proliferation of breast cancer cells by regulating GLUT3 expression through transcriptional crosstalk between hypoxia induced factor and p53

doi: 10.1101/2020.07.30.228759

Figure Lengend Snippet: a , Gene expression level quantified by RT-qPCR of glycolytic genes in MEF #1 obtained from three independent samples. Data are expressed as relative to MEF WT. b , Glut3 mRNA levels quantified by RT-qPCR in MEF #3 (n=3 independent experiments). c , mRNA level of RIP140 quantified by RT-qPCR in MCF7 after RIP140 silencing by two different specific siRNA (n=3 independent experiments). d , Protein expression level of GLUT3 and Actin quantified by western blot in MEF #1. Unprocessed original scans of blots are shown in . e , Knockdown efficiency of Glut3 by specific shRNA was determined by western blot (left panel) and RT-qPCR (right panel) (n=3 independent experiments). f , siRNA efficiency was verified by RT-qPCR for RIP140 (left panel) and GLUT3 (right panel) 48h after transfection in MDA-MD-436.

Article Snippet: GLUT3 shRNA (m) (sc-41219-V) were purchased from Santa Cruz Biotechnology (Dallas, USA).

Techniques: Gene Expression, Quantitative RT-PCR, Expressing, Western Blot, Knockdown, shRNA, Transfection

Journal: bioRxiv

Article Title: RIP140 inhibits glycolysis-dependent proliferation of breast cancer cells by regulating GLUT3 expression through transcriptional crosstalk between hypoxia induced factor and p53

doi: 10.1101/2020.07.30.228759

Figure Lengend Snippet: a , mRNA levels of RIP140 and GLUT3 quantified by RT-qPCR in MDA-MB-436 after RIP140 silencing by siRNA (n=3 independent experiments). b , mRNA levels of Glut3 quantified by RT-qPCR in MEF #1 overexpressing hRIP140 (n=3 independent experiments). c , Luciferase assay in MDA-MB-436 transiently transfected with TK-Renilla, GLUT3-Luc reporter plasmids and increasing doses of siRNA (siRIP140). Luciferase values were normalized to the renilla luciferase control. Data shown are from one representative experiment done in triplicates (Student-t-Test). d , Luciferase assay in MEF #1 transiently transfected with TK-Renilla, GLUT3-Luc reporter plasmids and increasing doses of c-Myc-RIP140 vector. Luciferase values were normalized to the renilla luciferase control. Data shown are from one representative experiment done in triplicates (Student-t-Test). e , Chromantin immunoprecipitation with anti-RIP140 (#ab42126) or IgG in MDA-MB-436. DNA bound DNA was amplified by qPCR with specific primers of the GLUT3 gene (SLC2A3). f , Number of colonies of transformed MEF #1 stably expressing shGLUT3 and expressed as percent of WT shControl (shC) (n=2 independent experiments). g , Cell proliferation measured by MTT assay of MEF #1 stably expressing an shRNA Control (shC) or a specific shRNA targeting Glut3 (shGLUT3) and normalized by that of MEF WT at day 1 for each shRNA (representative experiment, Student-t-Test). h , Cell viability assessed by crystal violet staining of MDA-MB-436 breast cancer cells after RIP140 siRNA silencing combined with siRNA GLUT3 (representative experiment, n=3 independent experiments). The proliferation of siRIP140 cells (siRIP) was expressed as relative to that of siControl cells (siC) for each conditions.

Article Snippet: GLUT3 shRNA (m) (sc-41219-V) were purchased from Santa Cruz Biotechnology (Dallas, USA).

Techniques: Quantitative RT-PCR, Luciferase, Transfection, Control, Plasmid Preparation, Immunoprecipitation, Amplification, Transformation Assay, Stable Transfection, Expressing, MTT Assay, shRNA, Staining

Journal: bioRxiv

Article Title: RIP140 inhibits glycolysis-dependent proliferation of breast cancer cells by regulating GLUT3 expression through transcriptional crosstalk between hypoxia induced factor and p53

doi: 10.1101/2020.07.30.228759

Figure Lengend Snippet: a , Luciferase assay in MEF #1 WT transiently transfected with TK-Renilla, GLUT3-Luc reporter plasmids and increasing doses of p53 vector. Luciferase values were normalized to the renilla luciferase control. Data shown are from one representative experiment done in triplicates (Student-t-Test). b , Luciferase assay in MEF #1 KO transiently transfected with TK-Renilla, GLUT3-Luc reporter plasmids, c-Myc-RIP140 and p53 vectors. Luciferase values were normalized to the renilla luciferase control. Data shown are from one representative experiment done in triplicates (Student-t-Test). c , p53 protein level quantified by western blot in MEF#1. Unprocessed original scans of blots are shown in . d , Luciferase assay in MEF #1 KO transiently transfected with TK-Renilla, GLUT3-Luc reporter plasmids and HA-HIF-1α or HA-HIF-2α vectors. Luciferase values were normalized to the renilla luciferase control. Data shown are from one representative experiment done in triplicates (Student-t-Test). e , HIF-1α and HIF-2α protein level quantified by western blot in MEF#1 in normoxia (21% O2). Unprocessed original scans of blots are shown in . f , GLUT3 mRNA level quantified by RT-qPCR in MEF #1 48h after HIF-2α silencing by siRNA(n=3 independent experiments). g , Luciferase assay in MEF #1 transiently transfected with TK-Renilla, HRE-Luc reporter plasmids and increasing doses of c-myc-RIP140 vector. Luciferase values were normalized to the renilla luciferase control. Data shown are from one representative experiment done in triplicates (Student-t-Test). h , Luciferase assay in MEF #1 KO transiently transfected with TK-Renilla, HRE-Luc reporter plasmids, HA-HIF-2α, c-myc-RIP140 (left panel) or p53 (right panel) expression plasmids. Luciferase values were normalized to the renilla luciferase control. Data shown are from one representative experiment done in triplicates (Student-t-Test). i , Luciferase assay in MEF #1 KO transiently transfected with TK-Renilla, HRE-Luc reporter plasmids, HA-HIF-2α and p53 expression plasmids in combination with c-myc-RIP140 vector. Luciferase values were normalized to the renilla luciferase control. Data shown are from one representative experiment done in triplicates (Student-t-Test). j , Luciferase assay in MEF #1 KO transiently transfected with TK-Renilla, GLUT3-Luc reporter plasmids, HIF-2α and p53 expression plasmids in combination with c-myc-RIP140 vector. Luciferase values were normalized to the renilla luciferase control. Data shown are from one representative experiment done in triplicates (Student-t-Test). k , Proximity ligation assay in MEF #1 WT between RIP140 and HIF-2α using rabbit anti-RIP140 and mouse anti-HIF-2α, between RIP140 and p53 using rabbit anti-RIP140 and mouse anti-p53 and between p53 and HIF-2α using mouse anti-p53 and rabbit anti-HIF-2α to detect endogenous proteins (left panel). Dots were quantified with the Duolink Software from 5 independent microscopic fields (right panel).

Article Snippet: GLUT3 shRNA (m) (sc-41219-V) were purchased from Santa Cruz Biotechnology (Dallas, USA).

Techniques: Luciferase, Transfection, Plasmid Preparation, Control, Western Blot, Quantitative RT-PCR, Expressing, Proximity Ligation Assay, Software

Journal: bioRxiv

Article Title: RIP140 inhibits glycolysis-dependent proliferation of breast cancer cells by regulating GLUT3 expression through transcriptional crosstalk between hypoxia induced factor and p53

doi: 10.1101/2020.07.30.228759

Figure Lengend Snippet: Kaplan-Meier analysis plotting the survival curve of 1068 cases of breast cancer with statistical significance being assessed using the log-rank test from the TCGA dataset. a , Kaplan-Meier curves showed worse overall survival rates for breast cancer patients with low RIP140 expression compared to patients with high RIP140 expression (P=0.042; left panel). Kaplan-Meier curves showed worse overall survival rates for breast cancer patients with high GLUT3 (SLC2A3) expression compared to patients with low GLUT3 expression (P=0.01; right panel). b , GLUT3 expression groups have been defined on the basis of the median GLUT3 expression. Kaplan-Meier curves showed better overall survival rates for breast cancer patients with high RIP140 expression in low GLUT3 expression group (P=0.0021; left panel). On the contrary, RIP140 prognostic value was not significant in high GLUT3 expression group (P=0.68). c , Groups have been defined on the basis of the median p53 (TP53), HIF-2α (EPAS1) and HIF-1α (HIF1A) expression. RIP140 prognostic value was significant in high p53 (P=0.0081), low HIF-2α (P=0.0016) and low HIF-1α (P=0.015).

Article Snippet: GLUT3 shRNA (m) (sc-41219-V) were purchased from Santa Cruz Biotechnology (Dallas, USA).

Techniques: Expressing

Journal: bioRxiv

Article Title: RIP140 inhibits glycolysis-dependent proliferation of breast cancer cells by regulating GLUT3 expression through transcriptional crosstalk between hypoxia induced factor and p53

doi: 10.1101/2020.07.30.228759

Figure Lengend Snippet: Kaplan-Meier of 1068 cases of breast cancer with statistical significance being assessed using the log-rank test from the TCGA dataset. a , Groups have been defined on the basis of the median p53 (TP53, top panel), HIF-2α (EPAS1, middle panel) and HIF-1α (HIF1A, bottom panel) expression. Kaplan-Meier analyses plotting the survival curved used to define RIP140 prognostic value in . b , GLUT3 expression groups have been defined on the basis of the median GLUT3 expression for colon and stomach cancer patients. RIP140 prognostic value was significantly associated with better overall survival in low GLUT3 expression group (colon, P=0.048; stomach, P=0.022).

Article Snippet: GLUT3 shRNA (m) (sc-41219-V) were purchased from Santa Cruz Biotechnology (Dallas, USA).

Techniques: Expressing

Journal: bioRxiv

Article Title: RIP140 inhibits glycolysis-dependent proliferation of breast cancer cells by regulating GLUT3 expression through transcriptional crosstalk between hypoxia induced factor and p53

doi: 10.1101/2020.07.30.228759

Figure Lengend Snippet: Model: RIP140 inhibits tumorigenesis by affecting glycolysis through the blockade of GLUT3 expression. RIP140 and p53 cooperate to inhibit the expression of GLUT3 induced by HIF-α. Glycolysis-dependent proliferation of breast cancer cells is reduced, due to a decrease in glycolysis. The prognostic value of RIP140 is associated with good survival in patients with low GLUT3, high p53 and low HIF-α (right panel). In patients with high HIF-α, low p53 and high GLUT3, RIP140 and p53 do not inhibit the transcriptional activity of HIF-α; GLUT3 is highly expressed and glycolysis is enhanced. In this sub-group, RIP140 expression level is not correlated with good survival. Double blue lines represent cell membranes. The grey square represents GLUT3 gene, the grey ovoid forms represent GLUT3 protein. The orange circle represents glucose.

Article Snippet: GLUT3 shRNA (m) (sc-41219-V) were purchased from Santa Cruz Biotechnology (Dallas, USA).

Techniques: Expressing, Activity Assay

Journal: Cellular and molecular life sciences : CMLS

Article Title: RIP140 inhibits glycolysis-dependent proliferation of breast cancer cells by regulating GLUT3 expression through transcriptional crosstalk between hypoxia induced factor and p53.

doi: 10.1007/s00018-022-04277-3

Figure Lengend Snippet: Fig. 7 Model describing how RIP140 inhibits tumorigenesis by affecting glycolysis through the blockade of GLUT3 expres- sion. RIP140 and p53 cooper- ate to inhibit the expression of GLUT3 induced by HIF-α. Glycolysis-dependent prolif- eration of breast cancer cells is reduced, due to a decrease in glycolysis. The prognostic value of RIP140 is associated with good survival in patients with low GLUT3, high p53 and low HIF-α (left panel). In patients with high HIF-α, low p53 and high GLUT3, RIP140 and p53 do not inhibit the tran- scriptional activity of HIF-α; GLUT3 is highly expressed and glycolysis is enhanced. In this sub-group, RIP140 expression level is not correlated with good survival (right panel). Double thick blue lines represent cyto- plasmic membranes, double thin ones that of nucleus. The grey square represents GLUT3 gene, the grey ovoid forms represent GLUT3 protein. The orange circle represents glucose.

Article Snippet: Immortalized MEF#1 were transduced with lentiviral particles expressing shRNA against murine GLUT3 (sc41219-V) according to the manufacturer’s protocol (Santa Cruz Biotechnology, Dallas, USA).

Techniques: Expressing, Activity Assay